1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mars2501 [29]
3 years ago
7

Draw the major product for the reaction of 1-butyne with water in the presence of catalytic TfOH (i.e., CF3SO3H). Then answer th

e additional question regarding this transformation.
Chemistry
1 answer:
Mademuasel [1]3 years ago
4 0

Answer:

2-Butanone

Explanation:

From the given information:

The presence of mercury as an acid catalyst brings about the addition of water to the triple bond which yields enol. Then, according to Markownikov's rule and after tautomerism has occurred, we have a methyl ketone ( 2- Butanone) as the product.

The answer regarding the transformation is addition and hydration.

You might be interested in
Which muscles are voljntary
kirill [66]
There are three types of muscle, skeletal or striated, cardiac, and smooth. Muscle action can be classified as being either voluntary or involuntary. Cardiac and smooth muscles contract without conscious thought and are termed involuntary, whereas the skeletal muscles contract upon command.
6 0
2 years ago
Which element of the periodic table is named after the moon
Troyanec [42]

Answer:

The answer to your question is Selenium

Explanation:

The origin of the names of the elements comes from different origins

For example

Sanskrit words. 14 elements have roots from this language

Planets, 4 elements took their names from the planets.

Greek, 42 elements took their names from these languages

The name of Selenium comes from the greek that means moon.

8 0
3 years ago
Write the IUPAC names for the following compounds.
atroni [7]
Benzine
Bromine
Clorine
5 0
2 years ago
What characterizes a Homo genesis mixture
Salsk061 [2.6K]

Answer:

The correct answer would be the third choice.

Homo-genesis mixtures are the same in composure, and will be hard to break apart other then with chemical means.

Hope this helps!

6 0
3 years ago
As a human being, we are considered to be a ..... because we rely on other organism for food​
ryzh [129]
Heterotrophs i think :)

3 0
3 years ago
Read 2 more answers
Other questions:
  • A substance that can donate a pair of electrons to form a covalent bond is known as a(n) _____ base.
    11·2 answers
  • In order to design an experiment, you need a ____ about the scientific question you are trying to answer. A. decision B. procedu
    12·1 answer
  • How many atoms of Oxygen (O) in the reactants of the equation below:
    13·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Please help thanks very much extra points given
    5·2 answers
  • Question 8 of 50
    7·2 answers
  • In a calorimeter, you combine 60 mL of a 0.983 M HNO3 solution with 40 mL of a 1.842 M NaOH solution. The reaction releases 3.24
    6·1 answer
  • A certain metal M forms a soluble sulfate salt M2SO4. Suppose the left half cell of a galvanic cell apparatus is filled with a 5
    13·1 answer
  • HEY ITS E AGAIN HELP ITS A TEST
    8·1 answer
  • In scientific notation, the number 0.00262 is expressed as
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!