1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Yanka [14]
3 years ago
10

PLEASE HELP!!!!!

Chemistry
1 answer:
Blababa [14]3 years ago
4 0
It would be water. Since the body is 60-75% water, it is important in chemical reactions within the body.
You might be interested in
What is the main intermolecular force in H2CO?
aivan3 [116]
Dipole-dipole interactions, and London dispersion interactions
5 0
4 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
Help with atoms WILL MARK BRAINLIEST
Eddi Din [679]

Answer:

C 1:1

Explanation:

Hydrogen loses an electron to becone +1 which is a cation and flourine gains that electron to have a full outer shell on the 2p subshell to become -1 and is an anion so the ratio is 1:1.

4 0
2 years ago
Analizando una biomolécula X, un científico comprueba que está formada por Carbono, Hidrógeno, Oxígeno y Nitrógeno, además de li
Cloud [144]

Analyzing a biomolecule X, a scientist verifies that it is made up of Carbon, Hydrogen, Oxygen and Nitrogen, in addition to releasing water when it joins with other similar molecules to form polymers. Considering these antecedents, it can be inferred that biomolecule X corresponds to: A Steroids B fatty acid C nucleotide D amino acid E monosaccharide (for people who dont speak spanish)

ok you answer is probably A

if wrong C maybe

~hope~

6 0
3 years ago
Use the periodic table to determine the electron configuration for Ca and Pm in noble-gas notation Ca: [Ar]4s2 [Ar]4s1 [Ar]3s2 [
sveta [45]
Answer:

1) Ca: [Ar]4s²
2) Pm: [Xe]6s²4f⁵

Explanation:

1) Ca:

Its atomic number is 20. So it has 20 protons and 20 electrons.

Since it is in the row (period) 4 the noble gas before it is Ar, and the electron configuration is that of Argon whose atomic number is 18.

So, you have two more electrons (20 - 18 = 2) to distribute.

Those two electrons go the the orbital 4s.

Finally, the electron configuration is [Ar] 4s².

2) Pm

The atomic number of Pm is 61, so it has 61 protons and 61 electrons.

Pm is in the row (period) 6. So, the noble gas before Pm is Xe.

The atomic number of Xe is 54.

Therefore, you have to distribute 61 - 54 = 7 electrons on the orbitals 6s and 4f.

The resultant distribution for Pm is: [Xe]6s² 4f⁵.
5 0
3 years ago
Read 2 more answers
Other questions:
  • What happens when More gases dissolve into magma
    6·2 answers
  • Which weighs more?
    7·1 answer
  • Consider the chemical equation. 2H2 + O2 mc022-1.jpg 2H2O What is the percent yield of H2O if 87.0 g of H2O is produced by combi
    11·2 answers
  • Which element must be present in an organic compound?(1) hydrogen (3) carbon(2) oxygen (4) nitrogen
    10·2 answers
  • Write the ΔH system for each of the following changes in physical state
    6·1 answer
  • Explain the large difference in boiling points between CH4 and CBr4
    9·1 answer
  • What particles contribute to the mass of an atom?
    13·2 answers
  • What is the ground-state electron configuration for the Mn4 ion and is it paramagnetic or diamagnetic?
    5·1 answer
  • Tin-126 has a half life of 100,000 years. How many years does it take to
    5·2 answers
  • How many molecules of co2 are in a 500. 0 ml container at 780 mm hg and 135°c? 8. 76 × 1021 molecules 9. 23 × 1021 molecules 5.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!