1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lera25 [3.4K]
2 years ago
6

1. Give one word for each of the following descriptions

Chemistry
1 answer:
Otrada [13]2 years ago
6 0

Alkyl halide, Isobutylene

Explanation:

You might be interested in
NEED HELP FAST
andre [41]

Answer: im not writting a pharaphraph. Buuuuuuuuuuuut... explian the type of reaction then explanie how that type of reaction works.

Explanation:

6 0
2 years ago
Read 2 more answers
What is the balanced NET ionic equation for the reaction when aqueous Cs₃PO₄ and aqueous AgNO₃ are mixed in solution to form sol
rusak2 [61]

Answer:

PO_4^{3-}(aq)+3Ag^+(aq)\rightarrow Ag_3PO_4(s)

Explanation:

Hello!

In this case, since the net ionic equation of a chemical reaction shows up the ionic species that result from the simplification of the spectator ions, which are those at both reactants and products sides, we take into account that aqueous species ionize into ions whereas liquid, solid and gas species remain unionized. In such a way, for the reaction of cesium phosphate and silver nitrate we can write the complete molecular equation:

Cs_3PO_4(aq)+3AgNO_3(aq)\rightarrow Ag_3PO_4(s)+3CsNO_3(aq)

Whereas the three aqueous salts are ionized in order to write the following complete ionic equation:

3Cs^+(aq)+PO_4^{3-}(aq)+3Ag^+(aq)+3NO_3^-(aq)\rightarrow Ag_3PO_4(s)+3Cs^+(aq)+3NO_3^-(aq)

In such a way, since the cesium and nitrate ions are the spectator ions because of the aforementioned, the net ionic equation turns out:

PO_4^{3-}(aq)+3Ag^+(aq)\rightarrow Ag_3PO_4(s)

Best regards!

7 0
2 years ago
_____ Ca(NO3)2 + _____ Fe → _____ Fe(NO3)3 + _____ Ca I need this done quick and fast Balancing chemical equations
cupoosta [38]

Answer:

3, 2, 2,3

..........................

8 0
3 years ago
What are all the elements to the left of the zigzag line in a periodic table called?
Kitty [74]
They are called metals
4 0
3 years ago
Which shows an isomer of the molecule below?
AnnyKZ [126]

Answer: C

Explanation:

Don’t trust the other person it’s not A

8 0
2 years ago
Read 2 more answers
Other questions:
  • Sodium nitrate and lead (ii) acetate express your answer as a chemical equation. identify all of the phases in your answer. ente
    7·2 answers
  • EXPLAIN why a skateboard coasting on a flat surface slows down and comes to a stop
    13·1 answer
  • the gravity Neptune is about 1.1 times the gravity of earth.how will the mass of an object on Neptune compare with its mass on e
    12·1 answer
  • Amateur radio operators in the United States can transmit on several bands. One of those bands consists of radio waves with a wa
    6·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Liquid ammonia boils at –33.4ºC and has a heat of vaporization of 23.5 kJ/mol. What is its vapor pressure at –50.0ºC? (R = 8.314
    12·1 answer
  • Element R and Element Q have the same number of valence electrons.These elements both haves similar chemical behavior, but Eleme
    9·1 answer
  • USE LETTERS FOR ANSWERS, NO NEED TO EXPLAIN
    8·1 answer
  • True/false... A molecule makes up a compound explain
    13·1 answer
  • Which of an Adams electrons are involved in chemical reactions
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!