1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kati45 [8]
3 years ago
9

What impact does bleached coral have on the ecosystem in which it lives?

Chemistry
1 answer:
Aloiza [94]3 years ago
8 0

Answer:

Bleached corals are likely to have reduced growth rates, decreased reproductive capacity, increased susceptibility to diseases and elevated mortality rates. Changes in coral community composition can occur when more susceptible species are killed by bleaching events.

You might be interested in
How many moles of Fe(OH)3 are produced when 85.0 L of iron(3) sulfate at a concentration of 0.600 mol/L reacts with excess NaOH
patriot [66]

Answer:

e = Mc hammer.

Explanation:

4 0
3 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
Which statement best describes a solution? A). a mixture consisting of minute particles suspended in a medium that start moving
makvit [3.9K]
The statement that best describes a solution is the option C: a mixture having a uniform composition where the components cannot be seen separately and all components are in the same state.<span> That is exactly what a solution is: a homogeneous mixture, the composition is uniform, but it can vary from one solution to other. The components must be in the safe phase, but it can be any phase: solid, liquid or gas. The most classical and clear example is the salt solution, NaCl. When you dissolve a spoon of NaCl in water you will not be able to distinguish nor separating the solute from the solvent, and the mixture will have uniform composition.</span>
3 0
3 years ago
An iron block of mass 18 kg is heated from 285 K to 318 K. If 267.3 kJ is required, what is the specific heat of iron? A. 450.00
valkas [14]

Answer:

  • <u>Option A. 450.00</u>

Explanation:

<u>1) Data:</u>

a) m = 18 kg

b) T₁ = 285 K

c) T₂ = 318 K

d) Q = 267.3 kJ

e) S = ?

<u>2) Principles and equations</u>

The specific heat of a substance is the amount of heat energy absorbed to increase the temperature of certain amount (gram, kg, or moles, depending on the definition or units) of the substance in 1 ° C or 1 K.

The mathematical relation between the specific heat and the heat energy absorbed is:

  • Q = m × S × ΔT

Where,

  • Q is the heat absorbed,
  • S is the specific heat, and
  • ΔT is the temperature increase (T₂ - T₁)

<u>3) Solution:</u>

<u>a) Substitute the data into the equation:</u>

  • 267.3 kJ = 18 kg × S × (318 K - 285 K)

<u>b) Solve for S and compute:</u>

  • S = 267.3 kJ / (18 kg × 33 K) = 0.45 kJ / (Kg . K)

The options have not units, but I notice that the first answer is 1,000 times the answer I obtained, so I will make a conversion of units.

<u>c) Convert to J /( kg . k):</u>

  • 0.45 kJ / (Kg . K) × 1,000 J / kJ = 450 J / (kg . K)

Now we can see that the option A is is the answer, assuming the units.

6 0
3 years ago
Potassium (k combines with magnesium bromide (mgbr2 to form potassium bromide (kbr and magnesium (mg during a single replacement
Agata [3.3K]
In balancing reactions, the number of atoms on each side should be of equal number. It is the most important rule in reactions. Also, we should know the correct substances involved in the reaction. We do as follows:

2K + MgBr2 = 2KBr + Mg
5 0
3 years ago
Read 2 more answers
Other questions:
  • If the standard solutions had unknowingly been made up to be 0.0024 m agno3 and 0.0040 m k2cro4, would this have affected your r
    6·2 answers
  • Why would a block of wood have more friction than a cube
    15·1 answer
  • Which of the following statements is true of cations?
    14·1 answer
  • Why is photosynthesis so important to plants, and can't animals use it?
    10·2 answers
  • Provide examples of physical weathering and chemical weathering in the chart below
    8·1 answer
  • A scientist is observing a cell in notices the presence of starch what does this tell her about the cell
    7·1 answer
  • Can somebody try and answer 1 of these questions also for 5 answer in 3 sentences thx!!!!
    5·1 answer
  • How is structure linked to function? <br><br><br><br><br> please no upload files.
    15·1 answer
  • Write the empirical formula of at least four binary ionic compounds that could be formed from the following ions: Ca^2 , Al^3 ,I
    9·1 answer
  • Can someone help me??
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!