1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vaselesa [24]
2 years ago
9

Which of the following pairs of compounds will react to form a precipitate? Why?

Chemistry
1 answer:
Ivanshal [37]2 years ago
4 0

Answer:

calcium chloride and silver nitrate

Explanation:

A precipitate is often formed in a double replacement reaction when the reaction yields an insoluble product.

Consider the reaction between calcium chloride and silver nitrate;

CaCl2(aq) + 2AgNO3(aq) -------->2AgCl(s) + Ca(NO3)2(aq)

AgCl is insoluble in water, hence the reaction leads to the formation of a precipitate.

You might be interested in
Use the reaction 1₂(s) = 12(g), AH = 62.4 kJ/mol, AS = 0.145 kJ/(mol-K), for
Sati [7]

The Reaction is spontaneous when temperature is 430 K. Hence, Option (C) is correct.

<h3></h3><h3>What is Spontaneous reaction ?</h3>

Reactions are favorable when they result in a decrease in enthalpy and an increase in entropy of the system.

When both of these conditions are met, the reaction occurs naturally.

Spontaneous reaction is a reaction that favors the formation of products at the conditions under which the reaction is occurring.

According to Gibb's equation:

ΔG = ΔH - TΔS

ΔG = Gibbs free energy

ΔH = enthalpy change  = +62.4 kJ/mol

ΔS = entropy change  = +0.145 kJ/molK

T = temperature in Kelvin

  • ΔG  = +ve, reaction is non spontaneous
  • ΔG = -ve, reaction is spontaneous
  • ΔG   = 0, reaction is in equilibrium

ΔH - TΔS = 0 for reaction to be spontaneous

T = ΔH / ΔS

Here,

T = 500K

Thus the Reaction is spontaneous when temperature is 500 K.

Learn more about Gibbs free energy here ;

https://brainly.in/question/13372282

#SPJ1

3 0
2 years ago
Which one of the following pair has the same number of ions?
zhuklara [117]
Hahahaaaa none of the above but IF <span>(c) is
 
1/2 mole of NaCl and 1/3 mole of MgCl2 instead,

then C is the right ans :)</span>
6 0
3 years ago
Read 2 more answers
Is mayonnaise an element compound solution or colloids
Alenkinab [10]
The answer to your question is mayonnaise is colloids.
5 0
3 years ago
Read 2 more answers
What are three methods of measuring the volume of an object?
Anarel [89]
L×w×h=v
length times width times height equals volume
the order in which you multiply does not matter
5 0
3 years ago
What part of the underside of a geckos feet allows it to stick to surfaces ?
belka [17]

Answer:

the foot is an intricate part of the body, consisting of 26 bones, 33 joints, 107 ligaments and 19 muscles

Explanation:

I hope it helps you ✌

4 0
3 years ago
Read 2 more answers
Other questions:
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • 4. Explain why 50 g of liquid water at 0°C heats-up more quickly than 50 g of an ice water mixture at 0°C under the same conditi
    13·1 answer
  • How does the number of molecules in 1 mol of oxygen compare with the number of molecules in 1 mol of nitrogen?
    8·1 answer
  • What is the number of moles in 500L of He
    9·2 answers
  • If a parent cell has 23 chromosomes and reproduces asexually through mitosis,how many chromosomes will each of its daughter cell
    7·1 answer
  • Which part of homeostasis is this adorable puppy balancing out with his little stuffed animal buddy?
    14·1 answer
  • Calcium + nitrous acid → calcium nitrite<br> +<br> nitrogen monoxide<br> + water
    6·1 answer
  • How to write a balanced nuclear equation on how uranium can disintegrate to Actium​
    15·1 answer
  • A block of iron has a mass of 826 g. What is the volume of the block of iron whose density at 25°C is 7.9 ?
    7·1 answer
  • 1. Using the periodic table and your knowledge of patterns and trends on the table, which of the following elements is the best
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!