1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
blondinia [14]
2 years ago
6

Help me plz quick test

Chemistry
1 answer:
Ivanshal [37]2 years ago
8 0

Answer: color patterns

Explanation: can i get brainliest

You might be interested in
I need help with this question .
salantis [7]

Answer:

C

Explanation:

C is the best answer. The endocrine system releases and controls hormones, which are basically just signals sent through the body.

These hormones regulate homeostasis, which is how your body stays at regular levels / stays the same. It keeps your body at steady conditions.

7 0
3 years ago
Read 2 more answers
If you can smell your grandmother’s perfume from across the room, you are experiencing the result of which liquid property?
cestrela7 [59]
The appropriate answer is D. volatility. Volatility refers to the susceptibility of liquids to vaporize. Perfume is liquid when applied but because of volatility, it has a tendency to vaporize and so it will convert to a gas and diffuse across the room. The process by which a liquid changes to a vapor is called evaporation. 
5 0
3 years ago
A highly concentrated solution from which dilutions are typically made for laboratory used is called a what?
Komok [63]
A stock solution is the most concentrated
4 0
3 years ago
According to valence bond theory, which orbitals overlap in the formation of the bond in hcl?
gulaghasi [49]
According  to  valence  bond  theory    sigma  bonds   is  formed when   two  orbitals  approach  and overlap  over  each  other   while     pie  bonds  is  formed  when   two  orbitals  overlap  side  by  side. in formation  of    HCl   1s  orbital  of  hydrogen  overlap  on   3p  orbitals  of  chlorine
8 0
3 years ago
Read 2 more answers
The half life for the decay of radium is 1620 years what is the rate constant
Lilit [14]
Decay is a type of degradation reaction and thus is considered a first order reaction. thus the formula goes like this.
 
rate constant= 0.693/half life

so here...

rate constant= 0.693/1620 year^-1 
3 0
3 years ago
Other questions:
  • Why is it not possible to directly count the number of particles in a mole?
    15·1 answer
  • Enter a balanced equation for the reaction between aqueous lead(II)(II) nitrate and aqueous sodium chloride to form solid lead(I
    14·1 answer
  • 1.
    9·2 answers
  • Look at the four images<br>Which image represents a tropical rainy climate?<br>1 2 3 4​
    15·2 answers
  • Which of the following solar phenomena is thought to cause short-term climate changes
    6·2 answers
  • Can you answer this question for me please
    15·1 answer
  • 16) What is the acceleration of an object with a mass of 31.5 kg when an unbalanced force
    12·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Where do fossils live
    8·2 answers
  • 25.88 grams of tin (ll) phosphate reacts with 31.73 grams of zinc.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!