1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ElenaW [278]
3 years ago
12

What is observed when an iron bar is

Chemistry
1 answer:
bija089 [108]3 years ago
5 0
Answer:
b). of copper (II) sulfate

I hope this helped :)
You might be interested in
How did Bohr refine the model of the atom? How did Bohr refine the model of the atom? He developed electrochemistry. He discover
BartSMP [9]

Answer:

He developed the concept of concentric electron energy levels

Explanation:

Before Bohr's model, Rutherford's model was proposed. This model explains most of the properties of the atom but failed to explain the stability of the atom.

As per Rutherford's model, electrons revolve around the nucleus in the orbit.

But revolving electron in their orbit around nucleus would give up energy and so gradually move towards the nucleus and therefore, eventually collapse.

Bohr's proposed that the electrons around the nucleus move orbit of fixed energy called "stationary states". Electrons in these stationary states  do not radiate energy.

Therefore, proposal of concentric electron energy levels refine the atomic models.

5 0
3 years ago
A solution has a [OH−] of 1 x 10−12. What is the pOH of this solution?<br> 2<br> 7<br> 10<br> 12
strojnjashka [21]
-log (1×10^-12) is how you calculate the pOH which in this case is 12
7 0
3 years ago
Read 2 more answers
A large rift valley can be found along the east coast of Africa. It has been slowly widening over time, and it is now wide enoug
Serjik [45]

Answer:

wind and water erosion

4 0
3 years ago
Read 2 more answers
Look at the following reaction. How could you increase the production of 2NH3(g)? N2(g) + 3H2(g) 2NH3(g) Increase the volume of
Zolol [24]
The correct option is B. To increase the production of ammonia, you have to increase the pressure of the system. Increase in pressure will result in increased production of ammonia because this will drive the chemical reaction forward.
5 0
3 years ago
Read 2 more answers
Where are stars that are in their giant or super giant stages located on the Hertzsprung-Russell diagram?
maxonik [38]
I’m pretty sure it’s A) upper right!
3 0
3 years ago
Other questions:
  • In order to digest food, the human body requires ​
    12·1 answer
  • The force of 20 N acts upon a 5kg block. What is the acceleration of the block?
    9·1 answer
  • Which is a polar molecule?
    10·1 answer
  • Calcium reacts with bromine to form calcium bromide. 2.1 Which atom will lose electrons? 2.2 How many electrons will it lose? 2.
    8·1 answer
  • An aspirin tablet weighing 0.400 g has been analyzed and contains 68.2% acetylsalicylic acid (ASA) (180.16 g/mol) by mass. A stu
    14·1 answer
  • Whats the balance to Sr + O, SrO​
    5·1 answer
  • Give the name (not formula) of the hydrocarbon
    9·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • In this reaction: Mg (s) + I₂ (s) → MgI₂ (s), if 10.0 g of Mg reacts with 60.0 g of I₂, and 53.88 g of MgI₂ form, what is the pe
    5·2 answers
  • A gas occupies a volume of 131.0-mL at 165.2-kPa. What volume will the gas occupy at 170.8-kPa if the temperature remains the sa
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!