1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aleks [24]
3 years ago
11

How is energy associated with food stored?

Chemistry
2 answers:
dangina [55]3 years ago
8 0

Answer: A. Potential energy in chemical form.

Explanation:

Energy can neither be created nor destroyed but can be transformed from one form to another.

The food we eat contains potential energy in the form of chemicals e. g Carbohydrates, that the body use in carrying out various biological activities.

disa [49]3 years ago
3 0
<span>potential energy in chemical form</span>
You might be interested in
How much heat in j is giving out when 85.0g of lead cools from 200.0 c to 10.0c
photoshop1234 [79]

Answer:

q = - 2067.2 J of Heat is giving out when 85.0g of lead cools from 200.0 c to 10.0 c.

Explanation:

The Specific Heat capacity of Lead is 0.128 \frac{J}{g\ ^{0}C}

This means, increase in temperature of 1 gm of lead by 1 ^{0}\ C will require 0.128 J of heat.

Formula Used :

q = m.c.\Delta T

q = amount of heat added / removed

m = mass of substance in grams = 85.0 g

c = specific heat of the substance = 0.128

q = m.c.\Delta T = Change in temperature

                                          = final temperature - Initial temperature

                                          = 10 - 200

                                          = -190 ^{0}\ C

put value in formula

q = -  85\times 0.128\times 190

On calculation,

q = - 2067.2 J

- sign indicates that the heat is released in the process

5 0
3 years ago
Liquids and gases are matter because they take up space and have
Aneli [31]
Volume. Gases and liquids are typically measured in milliliters (mL) or cubic centimeters (cm^3) - both of which are equivalent (1 mL = 1 cm^3).
8 0
3 years ago
3. What role did the government play in either supporting or suppressing African Americans'/Blacks'
9966 [12]
Slavery played a big role in this. the confederacy allowed slavery while the union was oppose to it.
4 0
3 years ago
Determine the number of valence electrons for the following: [kr] 5s2 4d6
wlad13 [49]

Answer: B) 2 (as indicated by electron distribution shown), but taking into account the real properties of this element, 4,7,8 also occur (see below).

Explanation:

This is the electron complement/atomic number of ruthenium, which actually has the structure [Kr] 5s1 4d7

Nevertheless, Ru does not form Ru(I) compounds and few Ru(II) compounds (RuCl2, RuBr2, RuI2). It also forms Ru(III)Cl3 and a larger number of Ru(IV) compounds, e.g. RuO2, RuS2. It also forms RuO4

3 0
3 years ago
A tank of oxygen with a pressure of 23 atm is moved from room temperature of 293K to a storage freezer at 239K. What is the fina
Gelneren [198K]

Answer:

18.76atm

Explanation:

Using the formula V1P1/T1 = V2P2/T2, from combined gas law. Volume is constant since we have not been given. Therefore the formula comes to be; P1/T1 = P2/T1

To get P2 = T2(P1/T1)

Where P2 is final pressure

P2 = 239K ( 23atm/293K)

=18.76atm

7 0
3 years ago
Other questions:
  • How many moles of sodium metal are needed to make 3.6 moles of sodium chloride?
    12·1 answer
  • The term that describes two or more objects in a system reaching the same temperature is
    8·1 answer
  • A star has a size of 0.1 solar radius. How many times larger is the sun than this star?
    10·1 answer
  • How many moles of C6H12O2 are needed to get 12 moles of CO2
    12·1 answer
  • The
    14·1 answer
  • How do clouds affect solar energy (radiation)?
    7·1 answer
  • Answers to student exploration : stoichometry (GIZMOS) WORTH 100 POINTS AND BRAINLIEST
    8·1 answer
  • What is the mass of 4.5 moles of sodium fluoride?
    14·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Is hydrogen the only non-metal positive ion?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!