1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dezoksy [38]
3 years ago
9

During life body pH is ___ shortly after death the pH becomes ___ after time the pH becomes ___. (A) Acidic, neutral, basic (B)

Neutral, acidic, basic (C) Neutral, basic, acidic (D) Acidic, acidic, basic
Chemistry
1 answer:
Natalija [7]3 years ago
5 0
(B) neutral, acidic, basic.
You might be interested in
Please please help me please please help please please help me please please help please please
Tatiana [17]

Answer:

AU9NJ-BLVHV-TCLJS-54YTB

6 0
2 years ago
What is the volume of 12.0 moles of Cl2 gas at STP?
Ymorist [56]
The answer has to be 22.4L
3 0
2 years ago
Which analogy best represents a supersaturated solution? an empty elevator that has a maximum load of 20 people a single person
Karo-lina-s [1.5K]
25 people in an elevator that has a maximum load of 20 people
8 0
3 years ago
Read 2 more answers
The first method of determining the chemical composition of substances in space was to
ehidna [41]
<span>The first method to determine the chemical composition of a substance in space was using light. By determining red shift in the observed spectrum of light they could determine the elements they were observing. Different elements change the way light behaves and from this scientists can determine the makeup of things such as stars and nebulas.</span>
5 0
3 years ago
Read 2 more answers
Mid- ocean ridges normally form where tectonic plates are A. converging B. diverging. C. Stationary. D. sliding past each other
Tasya [4]

its B i know its is denfkrnkvjf, njbc

5 0
3 years ago
Other questions:
  • Given the balanced equation representing a reaction at 101.3 kPa and 298 K:
    8·1 answer
  • Write a letter to alfred Wegener supporting his theory of continental drift discuss the theory of plate tectonics fossil and roc
    15·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Octane has a higher boiling point than pentane because _____.
    12·1 answer
  • 2. What is the relationship between the scientific method and bias? Explain in detail.
    6·1 answer
  • Is frying an egg chemical or physical change
    12·2 answers
  • Describe outer core.
    6·1 answer
  • How many moles of sodium atoms do you have if you have 5.60 ~
    7·1 answer
  • Whats is tge electron configuration of Ag2+ please answer asap..
    11·1 answer
  • The struggle for existence against other members of an organisms species is
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!