Answer:
The number of electrons in a neutral atom is equal to the number of protons. The mass number of the atom (M) is equal to the sum of the number of protons and neutrons in the nucleus. The number of neutrons is equal to the difference between the mass number of the atom (M) and the atomic number (Z).
Explanation:
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer: Bacterial species where observed Typical number on cell Distribution on cell surface
Escherichia coli (common pili or Type 1 fimbriae) 100-200 uniform
Neisseria gonorrhoeae 100-200 uniform
Streptococcus pyogenes (fimbriae plus the M-protein) ? uniform
Pseudomonas aeruginosa 10-20 polar
Explanation:
Pili are structures that extend from the surface of some bacterial cells.
These are hollow, non-helical, filamentous appendages.
Hope it helps you
Answer: check explanation
Explanation:
In this question we are to find mass. In order to calculate the Mass, We need the values of two parameters, that is, the values given for the grade tow chain, and the value given for the mass per length.
Assuming the mass per length is 3 Kilogram per metre(kg/m) and the grade 70 tow chain length is 5 metre(m).
Therefore, the formula for calculating mass of the chain is given below;
Mass of the chain= mass per unit length(kg/m) × length ---------------------------------------------------------------------------------------------------------------------(1).
Mass of the chain= 3 kg/m × 5 m.
Mass of the chain= 15 kg.
