1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
matrenka [14]
2 years ago
10

10. Select the more polar bond in each of the following pairs: a) C and N or C and o b) N and F or N and O.

Chemistry
1 answer:
worty [1.4K]2 years ago
3 0
A) C and O
B) N and F
You might be interested in
What is the chemical symbol for iron
Genrish500 [490]
The atomic symbol for Iron is Fe, as the Latin word for Iron is <em>ferrum</em>.
7 0
2 years ago
Read 2 more answers
1: Scrieţi şi egalaţi ecuaţiile reacţiilor chimice de schimb prezentate mai jos: a) carbonat de sodiu + clorură de calciu = b) c
prisoha [69]

Answer:

AMBANTOT MO MALIGO KANA

5 0
3 years ago
A gas is at a pressure of 3.70 atm. What is this pressure in kilopascals?
Yanka [14]
Answer:
                =   374.90 kPa 

Calculation:
                  As we know atm and kiloPascal are related to each other as,

                                         1 atm  =  101.325 kPa
So,
                                    3.70 atm  =   X
Solving for X,
                                     X  = (3.70 atm × 101.325 kPa) ÷ 1 atm

                                     X  =  374.90 kPa 
7 0
3 years ago
Please help me I will give you the brain thing and extra points. image below part
jekas [21]
D is the correct answer... if u need in depth let me know
3 0
2 years ago
Read 2 more answers
You heat 51 grams of magnesium over a Bunsen burner for several minutes until it reacts with oxygen in the air. Then you weigh t
garik1379 [7]

Answer:

    The mass was there all along, it was just in the air. The weight of the oxygen from the air is not weighed in the beginning, only at the end as part of the product, making it seem like there is a total mass change.

8 0
2 years ago
Other questions:
  • List three physical properties of copper
    6·1 answer
  • Franco was told that he had mycarditis. He went home and researched the disease, and he determined that he had
    12·1 answer
  • Nitrogen has an atomic mass of about 14 amu and an atomic number of 7. How many neutrons does nitrogen have?
    12·2 answers
  • Which of these is a harmful interaction?
    7·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • How do different forms of transportation meet people’s transportation needs?
    12·1 answer
  • Which of these changes would be classified as producing a chemical change a. freezing water b. mixing salt and water to make a s
    7·1 answer
  • Which of the following is a transition element<br> A)H<br> B) He<br> C) Fr<br> D) Rn<br> E) Rh
    13·1 answer
  • 14) For the reaction P4(s) + 6 Hz(9) — 4 PH3(g)
    13·1 answer
  • Hat product forms at the anode during the electrolysis of molten nabr?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!