Answer:
Uh first of all this is algebra but I'll answer this
First distribute the three and 5 (Multiply them by both terms inside parenthesis.
3x-6=5x+20
Then add like terms
8x=14
Divide 8 by 8 and 8 by 14
x = 14/8
Explanation:
Answer:
β-hydroxyaldehyde (an aldol) namely 3-Hydroxy butanal.
Explanation:
When acetaldehyde is treated with dil.NaOH it undergoes self condensation as it contains alpha-hydrogen atom in its compound forming β-hydroxyaldehyde (an aldol) namely 3-Hydroxy butanal. This compound upon further heating will eliminate a molecule of water forming aldol condensation product namely Crotonaldehyde Or But-2-en-al. see the diagram attached.
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
Well they help us understand the properties of matter of course!
Answer:
2.00 L of a gas is collected at 25.0°C and 745.0 mmHg. What is the volume at STP? STP is a common abbreviation for "standard temperature and pressure." You have to recognize that five values are given in the problem and the sixth is an x. Also ... 273 1. A gas has a volume of 800.0 mL at minus 23.00 °C and 300.0 torr.
Explanation:
