Answer:
alternation of crops
Explanation:
Common legumes include clover, beans, peas, alfalfa, and peanuts. Thomas Jefferson suggested that farmers alternate their crops between different fields each year. They range from single cells up to large organisms measuring 50 centimeters or more.
I believe the change of state shown in the model is deposition.
Deposition is a process in which gases change phase and turns directly in solids without passing through the liquid phase. It is the opposite of sublimation.
One of the major difference between gases and solids is the distance between molecules; in gases the inter molecular spaces are large, while in solid they are very small, making solids be the most dense, with closely packed molecules. This is evident in the diagram, the phase changed from gases to solids.
Answer:
According to the Brønsted definition, an acid is a substance capable of donating a proton, and a base is a substance capable of accepting a proton. ... The species giving up the proton is HCl, an acid. The species accepting the proton is water, the base. The species Cl- is the conjugate base of HCl.
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
4.52 mol/kg
Explanation:
Given data:
Mass of lithium fluoride = 22.1 g
Mass of water = 188 g
Molality = ?
Solution:
Molality:
It is the number of moles of solute into kilogram of solvent.
Formula:
Molality = number of moles of solute / kilogram solvent
Mathematical expression:
m = n/kg
Now we will convert the grams of LiF into moles.
Number of moles = mass/ molar mass
Number of moles = 22.1 g/ 26 g/mol
Number of moles = 0.85 mol
Now we will convert the g of water into kg.
Mass of water = 188 g× 1kg/1000 g = 0.188 kg
Now we will put the values in formula.
m = 0.85 mol / 0.188 kg
m = 4.52 mol/kg
