The answer is D) Electromagnetic energy. This is not a type of energy that occurs when a vehicle is moving.
Answer:humans have put ridiculous amounts of carbon dioxide into the atmosphereThese events are linked to the mass burning of fossil fuels to meet an increase in human demand
So the answer is True
Explanation:
Answer:
The relation between the shielding and effective nuclear charge is given as
where s denote shielding
z_{eff} denote effective nuclear charge
Z - atomic number
Explanation:
shielding is referred to as the repulsion of an outermost electron to the pull of electron from valence shell. Higher the electron in valence shell higher will be the shielding effects.
Effective nuclear charge is the amount of net positive charge that valence electron has.
The relation between the shielding and the effective nuclear charge is given as
wheres denote shielding
z_{eff} denote effective nuclear charge
Z - atomic number
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
In a dilute acid solution most if not all of the molecules will split into ions.
For example HCl is a strong acid and 100% of the molecules will split into
H+ & Cl-
in a weak acid solution only a portion of the molecules will turn into ions because the ionization percentage isn't as large. Which will essentially leave a high percentage of un-reacted molecules
