1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrew11 [14]
3 years ago
15

Potassium hydroxide is used to precipitate each of the cations from their respective solution. determine the minimum concentrati

on of koh required for precipitation to begin in each case.
Chemistry
1 answer:
MAXImum [283]3 years ago
8 0
This is the three cases that help to determine the minimum concentration of KOH required for precipitation 
Part a) 1.5×10^−2 M K CaCl2 
Part b) 2.3×10^−3 M Fe (NO3)2 
Part c) 2.0×10^−3 M MgBr2

a) CaCl2 + 2KOH --> Ca (OH) 2 + 2KCl Ca (OH) 2 <=> Ca^2+ + 2OH^- 
ksp = 1.5*10^-2 + x^2 
4.68*10^-6 = 1.5*10^-2 + x^2 
x= [KOH] = 0.01766 

b) Fe (NO3)2 +2 KOH--> Fe (OH)2 + 2KNO3 
Fe (OH)2 <=> Fe^2+ + 2OH^- 
ksp = 2.3*10^-3 + x^2 
4.87*10^-17 = 2.3*10^-3 + x^2 
x= 1.46*10^-7 

c) MgBr2 + KOH --> Mg (OH) 2 + 2KBr 
Mg (OH) 2 <=> Mg^2+ + 2OH^- 
ksp = 2.0*10^-3 + x^2 
2.06*10^-13 = 2.0*10^-3 + x^2 
x= 1.015*10^-5
You might be interested in
An air mattress is filled with 16.5 moles of air. The air inside the mattress has a temperature of 295 K and a gauge pressure of
postnew [5]
PV=nRT
3.5×X=16.5×0.082×295
X= 114 L
The volume of the air mattress is 114 liters.
7 0
3 years ago
Read 2 more answers
How many liters of carbon dioxide will be produced when 89.5 L of ethane are burned? (One mole of any gas occupies 22.4 L under
yan [13]

Answer:

179 L of CO2

Explanation:

Given the equation of the reaction;

C2H6(g) + 7/2 O2(g) -------> 2CO2(g) + 3H2O(g)

Now 1 mole of ethane yields 2 moles of CO2 from the balanced reaction equation

1 mole of a gas occupies 22.4 L volume so,

22.4 L of ethane yields 44.8 L of CO2

89.5 L of ethane yields 89.5 * 44.8/22.4 = 179 L of CO2

4 0
2 years ago
Which of these does not cause a change in the reaction rate?
VMariaS [17]
A. density
<span>Reaction rate increases with concentration.</span>
8 0
3 years ago
Read 2 more answers
Which two elements make up the greatest percentages by mass in Earth’s crust?
yuradex [85]
<h2><u>Answer</u> :</h2>

The most appropriate option is :

\hookrightarrow \bf2. \:  \mathrm{ \underline{oxygen \:  \: and \:  \: silicon}}

Since, they are the most abundant elements found in Earth's Crust.

  • Oxygen (46%)

  • Silicon (28%)

\circ  { \underline{ \boxed{ \sf{ \color{green}{ \mathrm{hope \:  \: it \:  \: helps \:  \: you .....}}}}}}∘

4 0
2 years ago
What type of rock commonly often contains gas bubbles and the mineral(s) hornblende, muscovite, olivine, lucite, and/or plagiocl
olga_2 [115]

Scoria

Explanation:

Scoria is a  rock that is commonly made up of gas bubbles and minerals such as hornblende, muscovite, olivine, lucite and or plagioclase.

Scoria is an extrusive igneous rock with a lot of cavities and vesicles indicating gas bubbles.

  • Scoria is product of basaltic magma.
  • It has nearly the same composition as basalt since it originates from it.
  • They silica deficient and very fine grained with holes in them.
  • The holes shows channels by which trapped gases are forcefully ejected out.
  • They are usually found associated with cindercone volcanoes.

learn more:

Volcanoes brainly.com/question/5055821

#learnwithBrainly

4 0
3 years ago
Other questions:
  • How many atoms are in KCI
    12·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Use the periodic table to identify the element with the electron configuration 1s²2s²2p⁴. Write its orbital diagram, and give th
    14·1 answer
  • a mechanical pencil has the mass of 55.5 grams the volume of the pencil is 11.5 cubic centimeter what is the density of the penc
    6·1 answer
  • Which one of the following is not a compound?
    5·1 answer
  • Lipid bilayers:A. depend on hydrophobic interactions to arrange the polar head groups together in the interior of the bilayer. B
    14·1 answer
  • Is the following equation balanced? Why or why not?<br> 2H2 +02 → 2H,0
    12·1 answer
  • acetylene gas c2h2 undergoes combustion to produce carbon dioxide and water vapor How many grams of water are produced by the sa
    6·1 answer
  • g You observed the formation of several precipitates in the Reactions in Solution lab exercise. Identify the precipitate in each
    6·1 answer
  • When studying seismological data scientists use data from...
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!