1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zmey [24]
3 years ago
7

If 1.9 kJ of heat is transferred to 96 g aluminum at 113°C, what would the

Chemistry
1 answer:
erastova [34]3 years ago
4 0

Answer:

T2 = 135.1°C

Explanation:

Given data:

Mass of water = 96 g

Initial temperature = 113°C

Final temperature = ?

Amount of energy transfer = 1.9 Kj (1.9×1000 = 1900 j)

Specific heat capacity of aluminium = 0.897 j/g.°C

Solution:

Formula:

Q = m.c. ΔT

Q = amount of heat absorbed or released

m = mass of given substance

c = specific heat capacity of substance

ΔT = change in temperature

ΔT = T2 - T1

Now we will put the values in formula.

Q = m.c. ΔT

1900 j = 96 g × 0.897 j/g.°C × T2 - 113°C

1900 j = 86.112 j/°C × T2 - 113°C

1900 j / 86.112 j/°C = T2 - 113°C

22.1°C + 113°C =  T2

T2 = 135.1°C

You might be interested in
A sample of air was collected on a day when the total atmosphere pressure was
zhuklara [117]

Answer:

1. The gas law used: Dalton's law of partial pressure.

2. Pressure of nitrogen = 331 mmHg

Explanation:

From the question given above, the following data were obtained:

Total pressure (Pₜ) = 592 mmHg

Pressure of Oxygen (Pₒ) = 261 mmHg

Pressure of nitrogen (Pₙ) =?

The pressure of nitrogen in the sample can be obtained by using the Dalton's law of partial pressure. This is illustrated below:

Pₜ = Pₒ + Pₙ

592 = 261 + Pₙ

Collect like terms

592 – 261 = Pₙ

331 = Pₙ

Pₙ = 331 mmHg

Therefore, the pressure of nitrogen in the sample is 331 mmHg

5 0
3 years ago
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
3 years ago
How spectral lines are formed
Ket [755]

=Spectral lines are produced by transitions of electrons within atoms or ions. As the electrons move closer to or farther from the nucleus of an atom (or of an ion), energy in the form of light (or other radiation) is emitted or absorbed.…

3 0
2 years ago
Read 2 more answers
3.25*10^25 atoms of neon gas equals how many moles of neon gas?
charle [14.2K]
Mole<span>: the amount of a substance that contains 6.02 x </span>10<span>. 23 respective particles of that substance. Avogadro's number: 6.02 x </span>10<span>. 23. Molar Mass: the mass of one </span>mole<span> of an element. CONVERSION FACTORS: 1 </span>mole<span> = 6.02 x </span>10<span>. 23 </span>atoms<span> 1 </span>mole<span> = </span>atomic<span> mass (g). Try: 1. How </span>many atoms<span> are in 6.5</span>moles<span> of zinc</span>
3 0
3 years ago
Read 2 more answers
Which of these atoms has the largest number of neutrons in the nucleus?
viktelen [127]

Holonium and Gadolinium has the highest number of neutrons in the nucleus.

Looking at the atoms listed;

Dysprosium has 66 protons

Holonium has 67 protons

Neodymium has 60 protons

Europium has 63 protons

Gadolinium has 64 protons

Then,

Number of neutrons = Mass number - number of protons

For Dysprosium

157 - 66 = 91 neutrons

For Holonium

162 - 67 = 95 neutrons

For Neodymium

149 - 60 = 89 neutrons

For Europium

148 - 63 = 85 neutrons

For Gadolinium

159 - 64 = 95 neutrons

Hence, Holonium and Gadolinium has the highest number of neutrons in the nucleus.

Learn more: brainly.com/question/14156701

8 0
3 years ago
Other questions:
  • What is this plzzzzzzzzzzzzzzzzzzz help!!!!
    15·1 answer
  • What are the 5 steps of a cloud forming and how would I draw it
    9·1 answer
  • Determine the amount of energy required to boil 50 g of<br> ethanol.
    7·1 answer
  • The density of alcohol is 0.85g/ml. what is the mass of 50ml of alchahol
    7·1 answer
  • After some wood has completely burned in a fire, some of the matter that made up the wood has been destroyed.
    6·2 answers
  • How to get proton? I need help, its due today
    5·2 answers
  • 10. Lead nitrate solution mixed with sodium sulfate solution forms lead sulfate as a
    7·1 answer
  • Which is an example of a three
    15·2 answers
  • Deshocribe how you could separate and purify compound A from a mixture of two neutral compounds (A and B) when A comprises 95% o
    6·1 answer
  • The deepest hole on Earth is only about 12 km deep. So, you should know that most of the data you collected in this virtual lab
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!