Answer:
1. The gas law used: Dalton's law of partial pressure.
2. Pressure of nitrogen = 331 mmHg
Explanation:
From the question given above, the following data were obtained:
Total pressure (Pₜ) = 592 mmHg
Pressure of Oxygen (Pₒ) = 261 mmHg
Pressure of nitrogen (Pₙ) =?
The pressure of nitrogen in the sample can be obtained by using the Dalton's law of partial pressure. This is illustrated below:
Pₜ = Pₒ + Pₙ
592 = 261 + Pₙ
Collect like terms
592 – 261 = Pₙ
331 = Pₙ
Pₙ = 331 mmHg
Therefore, the pressure of nitrogen in the sample is 331 mmHg
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
=Spectral lines are produced by transitions of electrons within atoms or ions. As the electrons move closer to or farther from the nucleus of an atom (or of an ion), energy in the form of light (or other radiation) is emitted or absorbed.…
Mole<span>: the amount of a substance that contains 6.02 x </span>10<span>. 23 respective particles of that substance. Avogadro's number: 6.02 x </span>10<span>. 23. Molar Mass: the mass of one </span>mole<span> of an element. CONVERSION FACTORS: 1 </span>mole<span> = 6.02 x </span>10<span>. 23 </span>atoms<span> 1 </span>mole<span> = </span>atomic<span> mass (g). Try: 1. How </span>many atoms<span> are in 6.5</span>moles<span> of zinc</span>
Holonium and Gadolinium has the highest number of neutrons in the nucleus.
Looking at the atoms listed;
Dysprosium has 66 protons
Holonium has 67 protons
Neodymium has 60 protons
Europium has 63 protons
Gadolinium has 64 protons
Then,
Number of neutrons = Mass number - number of protons
For Dysprosium
157 - 66 = 91 neutrons
For Holonium
162 - 67 = 95 neutrons
For Neodymium
149 - 60 = 89 neutrons
For Europium
148 - 63 = 85 neutrons
For Gadolinium
159 - 64 = 95 neutrons
Hence, Holonium and Gadolinium has the highest number of neutrons in the nucleus.
Learn more: brainly.com/question/14156701