Hello!
The part of the carbon cycle where humans had the greatest impact is the return of CO₂ to the atmosphere by burning of ancient organic matter.
The ancient organic matter is also called Fossil Fuels. Some Fossil Fuels are Petroleum and Coal. Fossil Fuels are used to power our society and are burned to provide energy for power plants and vehicles, and by burning them, Carbon Dioxide (CO₂) is produced, increasing the natural concentration of this compound in the atmosphere.
Have a nice day!
<h3>Because it is harmful for school environment.</h3>
Potassium Metal Is Explosive— Do Not Use It! The reaction of sodium with water is a spectacular and essential classroom demonstration. Many teachers want to show also the more violent reaction of potassium. We propose not to do so because explosions can happen even before the metal is in contact with water.
<em>-</em><em> </em><em>BRAINLIEST</em><em> answerer</em>
The harmonic law would suggest that Neptune will take a longer amount of time to orbit the sun than Mercury. That's what I think anyways
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
