Which of the following elements is the most reactive?

Chemistry

2 answers:

Maksim231197 [3]2 years ago

4 0

the following element that is most reactive would be Fluorine

Marta_Voda [28]2 years ago

4 0

I'm pretty sure its Bromine.

You might be interested in

the gas left in an used aerosol can is at a pressure of 103 kPa at 25 degrees celsius if this can be thrown into fire what is th

Rainbow [258]

Hello!

The pressure of the gas when it's temperature reaches 928 °C is 3823,36 kPa

To solve that we need to apply Gay-Lussac's Law. It states that the pressure of a gas when the volume is left constant (like in the case of a sealed container like an aerosol can) is proportional to temperature. This is the relationship derived from this law that we use to solve this problem:

$P2= \frac{P1}{T1}*T2= \frac{103 kPa}{25}*928=3823,36 kPa$

Have a nice day!

5 0

3 years ago

Read 2 more answers

Sugar O2 CO2 H2O What is the name of this energy pathway?

lys-0071 [83]

thnxx for free point? ?????????

7 0

2 years ago

Imporance of mixture in our daily life

garri49 [273]

Answer:A mixture is a mechanical combination of several elements or compounds. Mixtures are used in cooking, chemical manufacturing, and a lot of other processes. A good mixture with the materials evenly distributed facilitates a good after mixture process. That might be a chemical reaction or a great cake. One mixture that we see the results of a lot is the mixture of water, gravel, and Portland cement that, after a good mix, becomes concrete. Other mixtures might include the various plastics and epoxies that require two or more parts to become a finished product. There are so many possible mixtures out there I’d suggest chemical engineering books , chemistry books in general, cook books, books on construction processes, and many other possible sources of mixtures and the results of using them.

Explanation:

4 0

3 years ago

A chemical reaction is at equilibrium when:_______.a. the reaction occurs quickly. b. there is no reverse reaction possible, onl

Diano4ka-milaya [45]

Answer: D.

Explanation: A chemical reaction is said to be in a state of equilibrium when the rate of the forward reaction equals the rate of the backward reaction, thus, there is no net change in the concentration of reactants and products.

4 0

3 years ago

DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message

Katarina [22]

CGGAUUACGGGCUCAUUGUGGCCA

7 0

3 years ago