1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bas_tet [7]
2 years ago
13

Which of the following is a balanced chemical equation? A, H2O2 → H2O + O2

Chemistry
1 answer:
LenKa [72]2 years ago
3 0
I believe it's D! Hope you can help with my question!
You might be interested in
What is the IUPAC name Of<br> CH3-CH2-CH2-CH=O<br> I<br> COOH
Blizzard [7]

Answer:

Explanation:

It is Butanoic Acid

8 0
2 years ago
Read 2 more answers
An object has a density of 10.00 g/mL. If the object has a volume of<br> 25.00 ml, what is the mass?
SVEN [57.7K]

Answer:

The answer is

<h2>250 g</h2>

Explanation:

The mass of a substance when given the density and volume can be found by using the formula

<h3>mass = Density × volume</h3>

From the question

volume of object = 25 mL

Density = 10 g/mL

The mass of the object is

mass = 25 × 10

We have the final answer as

<h3>250 g</h3>

Hope this helps you

6 0
3 years ago
Why does soap decrease the surface tension of water?
e-lub [12.9K]

Answer:

Soap decreases surface tension by changing the way water behaves on the surface. Hard and soft water react differently when soap is added to them.

Explanation: i think it is this

8 0
2 years ago
What happens if you try to move the atoms very close to each other?
stellarik [79]
They push away from each other or repel due to the same charge they have.
4 0
2 years ago
A first order reaction B=C has a half life of
Lostsunrise [7]

Answer:

90.46 well that's how I got the answer from my calculations

5 0
2 years ago
Other questions:
  • I WILL MAKE YOU BRAINLIEST ! :Which factor varies between the isotopes of an element?
    9·2 answers
  • What is the solution to the problem to the correct number of significant figures (102,900/12)+(170•1.27)
    10·1 answer
  • Which of the following statements describe constructive interference
    5·1 answer
  • Consider two processes: sublimation of I2(s) and melting of I2(s) (Note: the latter process can occur at the same temperature bu
    12·2 answers
  • Which elements are included in group 5a
    11·1 answer
  • What is an atom? I'll give brainliest.
    5·1 answer
  • Formula unit of Magnesium oxide and Calcium bicarbonate and aluminum carbonate plzzzz​
    15·1 answer
  • Classify matter as elements mixtures and compounds
    12·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • water and ammonia are polar. The hydrogen atoms in each have a slight positive charge. What does that tell you about the oxygen
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!