1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SVEN [57.7K]
3 years ago
14

22.99 on the element sodium means the combined numbers of electrons and protons?

Chemistry
2 answers:
Anika [276]3 years ago
8 0

Answer:

The answer is 11 electron and 11 protons respectively

Explanation:

Since the sodium is in it neutral state, number of electron is the same as the number of proton, which is 11.

Hatshy [7]3 years ago
3 0

Answer:

Explanation:

you are welcome

You might be interested in
Which of the following is not an element that makes up all living organisms?
Bess [88]

Answer: Rubidium is correct

Explanation: The six most common elements in living things are carbon, hydrogen, oxygen, nitrogen, phosphorus, and sulfur. Atoms of these elements combine and form thousands of large molecules. These large molecules make up the structures of cells and carry out many processes essential to life.

8 0
3 years ago
Which statements about thermal energy are true? Choose all answers that are correct. A. Temperature is a measure of the average
Alekssandra [29.7K]
The answers that are correct are a, b, and d
3 0
3 years ago
1. If 80.0 ml of 3.00 M HCl is used to make a 100. ml of dilute acid, what is the molarity
Aleonysh [2.5K]

<u>We are given:</u>

M1 = 3 Molar        V1 = 80 mL

M2 = x Molar        V2 = 100 mL

<u>Finding the molarity:</u>

We know that:

M₁V₁ = M₂V₂

where V can be in any units

(3)(80) = (x)(100)

x = 240/100                                          [dividing both sides by 100]

x = 2.4 Molar

3 0
2 years ago
If your lawn is 21.0 ft wide and 20.0 ft long, and each square foot of lawn accumulates 1350 new snow flakes every minute. How m
GaryK [48]
<span>First we can calculate the area of the rectangular lawn using the formula:
Area = Width x Length = 21 ft x 20 ft = 420 square feet
       
And the total number of snow flakes per minute on the entire lawn is:
   
(1350 snowflakes per minute per square foot) x (420 square feet) = 567,000 snowflakes per minute
       
In one hour (or 60 minutes) we get a total of:
   
(567,000 snowflakes per minute) x (60 minutes / 1 hour) = 34,020,000 snowflakes
       
The total mass of which would be:
   
34,020,000 snowflakes x 1.60 mg = 54,432,000 mg = 54.432 kg (as 1 kg = 1,000,000 mg).
       
So 54.432 kg of snow accumulates every hour on the lawn.</span>
7 0
3 years ago
According to boyle’s law, when the pressure on a gas in an enclosed container increases, the volume of that gas
Doss [256]
Decreases. Hope I helped
3 0
3 years ago
Other questions:
  • What effect can new observations have on a scientific theory
    6·1 answer
  • If you have 6.02 x 1023 kittens, how many moles of kittens do you have?
    11·1 answer
  • Near the surface of a liquid, fast-moving particles can break free and become a gas.
    7·1 answer
  • Humans have developed different cat breeds using the process of selective breeding.
    5·2 answers
  • whats the strongest smell because the bodies in my basement is stinking really bad and i dont want people to find out can you re
    14·1 answer
  • Please help! How many grams is 4.5 x 10^27
    12·1 answer
  • Can gravity be considered a force?
    10·1 answer
  • I guess you didn’t mean what u wrote in that song about meee
    15·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • 3. A light bulb containing argon gas is switched on,
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!