1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
katen-ka-za [31]
3 years ago
6

Identify the reactants and the products in this chemical equation. 2Fe2O3 + 3C → 4Fe + 3CO2

Chemistry
1 answer:
aivan3 [116]3 years ago
7 0

Answer:

Fe₂O₃ and C are reactants

Fe and CO₂ are products

Explanation:

Reactants:

Chemical species that are present on left side of chemical reaction equation are called reactants.

Product:

Chemical species that are present on right side of chemical reaction equation are called product.

Chemical equation:

2Fe₂O₃ + 3C  →  4Fe + 3CO₂

In this reaction 2 mole of iron oxide is react with three moles of carbon and produced four moles of iron and three moles of carbon dioxide. There are equal numbers of atoms of all elements present on both side of chemical reaction so this reaction follow the law of conservation of mass.

Law of conservation of mass:

According to the law of conservation mass, mass can neither be created nor destroyed in a chemical equation.

Explanation:

This law was given by french chemist  Antoine Lavoisier in 1789. According to this law mass of reactant and mass of product must be equal, because masses are not created or destroyed in a chemical reaction.

You might be interested in
Match the following words with their definitions.
exis [7]

Answer: there is nothing there to answer

Explanation:

5 0
3 years ago
How many grams of precipitate will be formed when 20.5 mL of 0.800 M
Anton [14]

Answer:

There will be formed 1.84 grams of precipitate (NaNO3)

Explanation:

<u>Step 1</u>: The balanced equation

CO(NO3)2 (aq) + 2 NaOH (aq) → CO(OH)2 (s) + 2 NaNO3 (aq)

<u>Step 2:</u> Data given

Volume of 0.800 M  CO(NO3)2 = 20.5 mL = 0.0205 L

Volume of 0.800 M NaOH = 27.0 mL = 0.027 L

Molar mass of NaNO3 = 84.99 g/mol

<u>Step 3:</u> Calculate moles of CO(NO3)2

Moles CO(NO3)2  = Molarity * volume

Moles CO(NO3)2  = 0.800 M * 0.0205

Moles CO(NO3)2 = 0.0164 moles

Step 4: Calculate moles NaOH

moles of NaOH = 0.800 M * 0.027 L

moles NaOH = 0.0216 moles

Step 5: Calculate limiting reactant

For 1 mole CO(NO3)2 consumed, we need 2 moles of NaOH to produce 1 mole of CO(OH)2 and 2 moles of NaNO3

NaOH is the limiting reactant. It will completely be consumed.

CO(NO3)2 is in excess. There willbe 0.0216 / 2 = 0.0108 moles of CO(NO3)2 consumed. There will remain 0.0164 - 0.0108 = 0.0056 moles of CO(OH)2

Step  6: Calculate moles of NaNO3

For 2 moles of NaOH consumed, we have 2 moles of NaNO3

For 0.0216 moles of NaOH, we have 0.0216 moles of NaNO3

Step 7: Calculate mass of NaNO3

mass of NaNO3 = moles of NaNO3 * Molar mass of NaNO3

mass of NaNO3 = 0.0216 moles * 84.99 g/mol = 1.84 grams

There will be formed 1.84 grams of precipitate (NaNO3)

5 0
3 years ago
Can someone please answer the question, <br>What is heat?​
Levart [38]

Answer:

hot

Explanation:

6 0
3 years ago
Read 2 more answers
What is the standard deviation of this data set?
Firlakuza [10]
Answer to his question is C
3 0
3 years ago
Read 2 more answers
Isotopes of the same element will have a different number of neutrons, but the same number of protons. TRUE OR FALSE
Nikitich [7]

Answer:

TRUE

Explanation:

6 0
3 years ago
Other questions:
  • +
    5·1 answer
  • What type of glassware is useful for transferring liquids from a big container to a small container?
    8·2 answers
  • What acts as a buffer for seawater ?
    6·2 answers
  • When the equation: __al2(so4)3 + __zncl2 → __alcl3 + __znso4 is correctly balanced using the smallest whole number coefficients,
    7·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • What is the effect of decreasing concentration of sodium hydroxide ten times in standardization​
    6·1 answer
  • How many grams of iron metal do you expect to be produced when 305 grams of a 75.5 percent by mass iron(II) nitrate solution rea
    15·2 answers
  • (1.) Using Beer's Law, How will the absorbance measured for the solutions change as the concentration of aspirin in solutions in
    5·1 answer
  • What elements are in KHCO3
    6·1 answer
  • Gather data: Four other pairs of elements in the same chemical family are listed below. List the number of valence electrons in
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!