1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yaroslaw [1]
3 years ago
9

What is the test for identification of double bond?

Chemistry
2 answers:
kupik [55]3 years ago
5 0

Answer:

Bromine water test

There are two tests to detect the presence of unsaturated double bond in an organic molecule, the bromine water test and Bayer's test. In the bromine water test, when the molecule is added to bromine water, bromine is added to the carbon atoms across the double bond.

Tresset [83]3 years ago
3 0
Bromine water test is the answers
You might be interested in
In a cell, what is the function of the Cell Membrane?
joja [24]

The answer is C :

It controls the entry and exit of substances.

8 0
3 years ago
Can radiation carry thermal energy from object to object?
Viktor [21]

Answer:

Radiation is the transfer of thermal energy by waves that can travel through empty space. When the waves reach objects, they transfer thermal energy to the objects.

3 0
2 years ago
Read 2 more answers
Under what conditions of temperature and pressure is a gas least soluble in water
snow_tiger [21]

The conditions of temperature and pressure in which a gas least soluble in water is low pressure and high temperature.

<h3>What is Henry Law?</h3>

The amount of dissolved gas in a liquid is proportional to its partial pressure above the liquid, according to Henry's law.

From this law it is clear that:

  • As the pressure of the gas increases solubility of the gas on the liquid also increases.

But if the temperature of the liquid decreases then the solubility of the gas also increases.

Hence at low pressure and high temperature, gas is least soluble.

To know more about solubility of gas, visit the below link:

brainly.com/question/14747303

#SPJ4

7 0
2 years ago
What is the maximum mass of ethyl alcohol you could boil with 1000 j of heat, starting from 22 ∘c?
kramer

solution:

1000 = m*2400*(78-22) + m*8.79*10^5

1000= 134400m + 879000m

1000= 1030200m

m = 1000/1013400

m= 1013.4 grams

the final answer is 0.9706 grams


5 0
3 years ago
What is the difference between cellular respiration and photosynthesis
guapka [62]
Cellular respiration<span> is a set of metabolic reactions and processes that take place in the cells of organisms to convert biochemical energy from nutrients into adenosine triphosphate (ATP), and then release waste products
</span>
<span>Photosynthesis</span>- the process by which green plants and some other organisms use sunlight to synthesize foods from carbon dioxide and water. Photosynthesis in plants generally involves the green pigment chlorophyll and generates oxygen as a byproduct.

3 0
3 years ago
Other questions:
  • What energy conversion occurs when a plant uses energy from the sun to make sugar stored in fruit?
    6·1 answer
  • Summarize: How are matter and substances related?
    13·1 answer
  • When an element of theatre resembles observed reality, it is considered _______________?
    8·1 answer
  • the value of kc for the following reaction is 0.630 at 409 K N2O4(g) --&gt; 2NO2(g) if a reaction vessel at that temperature int
    12·1 answer
  • Carbon is found in all organic molecules. <br> a. True<br> b. False
    7·1 answer
  • If two reactions sum to an overall reaction, and the equilibrium constants for the two reactions are K1K1 and K2K2, what is the
    5·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Please help!!!
    10·1 answer
  • Calcium carbonate, CaCO3(s), the principal compound in limestone, decomposes upon heating to CaO(s) and CO2(g). A sample of CaCO
    10·1 answer
  • Help I really need help and don't search it on go.ogle this is a school assignment and i can get in trouble thank you sm :)
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!