1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna35 [415]
3 years ago
13

You burn a log on a fire. You use fire to warm yourself and help you see to read a book. What energy transformation is taking pl

ace?
Chemistry
1 answer:
Vinvika [58]3 years ago
5 0

Answer:

heat energy to keep you warm and light energy to be able to read your book

Explanation:

You might be interested in
If there are 94 different kinds of naturally occurring atoms how many different naturally occurring elements are there?
Delicious77 [7]

Answer:

118 elements

Explanation:

Of these 118 elements, 94 occur naturally on Earth.

7 0
2 years ago
Do you think it is appropriate to have diet pop available in your school?
pashok25 [27]

Answer:

I think so

Explanation:

It would provide an extra energy boost with lower sugars. Students bring drinks to school anyways so it would be nice to offer some that aren't as detrimental.

3 0
3 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
Which is the next logical step in balancing the given equation?
Leya [2.2K]

To balance the given equation, we apply elemental balance and count each elements per side. There are 2 nitrogens in the left side so there should be 2 moles of NO2. Since there are already 4 moles of O in the right side, there should be 2 moles of O2. Hence answer is a. Place the coefficient 2 in front of oxygen and nitrogen dioxide.

3 0
3 years ago
Read 2 more answers
Suppose that 100 grams of water at 50.0°C is placed in contact with 200 grams of iron at 30.0°C. The final
wel

Answer:

The answer would be 1.5 kJ.

Explanation:

When you use the equation q = m x c x ∆T you will be able to find the energy gained or lost. The data for the water in this case is just there to distract you so ignore it. :D

4 0
3 years ago
Other questions:
  • 2.
    11·2 answers
  • What are the intermolecular forces that exist between molecules of NH3, H2O and HF called ?
    15·1 answer
  • Help in number 10 please
    13·2 answers
  • At 20 degrees Celsius, the density of air is 1.20 g/L. Nitrogen's density is 1.17 g/L. Oxygen's density is 1.33 g/L. Will balloo
    12·2 answers
  • What is the transfer of heat by direct contact - occurs when the particles in a material collide with neighboring particles?
    12·1 answer
  • After use, non-biodegradable plastics last for many years in __________ sites. Many also pollute the ocean.
    12·1 answer
  • Help please<br> How many grams in 7.57 moles of Calcium Nitrate (Ca(NO3)2)
    15·1 answer
  • What is the correct name
    5·2 answers
  • The lower the pressure, the lower a liquid’s boiling point is. Water actually boils much faster at the top of a mountain where a
    8·1 answer
  • The chemical formula for acetone is: ch32co calculate the molar mass of acetone. round your answer to 2 decimal places.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!