Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
Cobalt chloride
Explanation:
It is a molecule formed of one Cobalt atom, and two Chlorine atoms.
"Polysaccharide carbohydrate" comprises an S. pneumoniae capsule.
<u>Option:</u> C
<u>Explanation:</u>
The lengthy sequences of carbohydrate molecules, primarily polymeric carbohydrates constructed of units of monosaccharides linked together through glycosidic connections, understood as Polysaccharides. This carbohydrate can respond to water by catalyzing amylase enzymes, which generate component sugars.
A major human pathogen is Streptococcus pneumoniae or pneumococcus. The virulence is primarily due to its polysaccharide envelope, which protects it from the recipient immune response, and this has led to comprehensive study of the shell.
