This indicates that the reaction is exothermic meaning that it releases heat/energy
Hi there! Air and sunlight can definitely be reused. Those are abundant and renewable resources. Therefore, A and D are eliminated. There is a limited amount of water, however, it's impossible to run out of it to the point that there's no more on Earth. C is out. The only answer choice that makes sense is coal, because it's a nonrenewable resource, and it takes millions of years to make more of. It's a fossil fuel, so once we use them up, we can't get anymore during our lives. The answer is B: coal.
Answer:
Redox
Explanation:
Reduction is gain of electrons
oxidation is loss of electrons
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer: 39.948 grams
Explanation:
The SI base unit for amount of substance is the mole. 1 mole is equal to 1 moles Ar, or 39.948 grams
