1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Effectus [21]
3 years ago
11

A student uses the apparatus to determine the concentration of a solution of hydrofluoric acid. Which component will

Chemistry
2 answers:
Marta_Voda [28]3 years ago
7 0

Answer:

1. water and a salt

2. Magnesium hydroxide reacts with HCl to produce a solution that is neutral.

3. titrant

4. 0.08 M

5. indicator

Explanation: I did it

Kryger [21]3 years ago
3 0

When determining the concentration of an acid solution, the titrant would usually be put in the burette while the analyte would be in the conical flask.

The titrant is usually a known solution while the analyte would be the unknown solution.

In order to determine the concentration of a solution of hydrofluoric acid, the acid would need to be titrated against a suitable base of known concentration using a suitable indicator to indicate the endpoint of the neutralization reaction.

Thereafter, the volume of the titrant used would be recorded and used to find the concentration of the acid (the analyte).

Thus, since the base would be known, it would be the one in the burette while the hydrofluoric acid would be the one in the conical flask.

More on titrant and analyte can be found here: brainly.com/question/22684609

You might be interested in
HELPP ME PLEASE!! What would be the density of a 40 g object that displaces 10 ml of water?
Snezhnost [94]

Answer:

<h2>The answer is 4.0 g/mL</h2>

Explanation:

The density of a substance can be found by using the formula

density =  \frac{mass}{volume} \\

From the question

mass = 40 g

volume = 10 mL

The density of the object is

density =  \frac{40}{10}  = 4 \\

We have the final answer as

<h3>4.0 g/mL</h3>

Hope this helps you

5 0
3 years ago
Colo Kelskemdkdood is the time of the time I
Valentin [98]

Answer:

Explanation:

what?

8 0
3 years ago
1. What temperature is equivalent to 32°F?
Vlad1618 [11]

Answer:

0 Celsius

Explanation:

its 0 degrees C

4 0
3 years ago
Read 2 more answers
ALUMINUM HAS THREE OUTER ELECTRONS Will the element share, gain, or lose electrons when bonding with another element? explain​
bearhunter [10]

Answer:

aluminum will lose 3 electrons.

Explanation:

to be stable and losing 3 is easier than gaining 5.

anddd its a metal. :)

7 0
2 years ago
The placement of carbonyl group of a kerose sugar is at second-carbon only (b) fir + carbon only () first and fast carbon (d) li
olasank [31]

Answer:

(d)

Explanation:

Carbonyl group can be the placement of kerosene sugar

6 0
3 years ago
Other questions:
  • For the reaction
    15·2 answers
  • What is the ph of a solution with a hydrogen ion h+ concentration of 10-8 m?
    8·1 answer
  • How many moles of KCl would be dissolved in 4 L of water to make a 2 M solution?
    5·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • How many total atoms are in 0.920 g of P2O5?
    10·2 answers
  • I need to find the orbit notation<br> 1. Ne - 1s 2s 2p 3s 3p 4s 3d 4p 5s​
    7·1 answer
  • How a cold front affects weather.
    12·2 answers
  • Give one example of an element and one compound.<br><br> Can someone help me with this pls
    12·1 answer
  • Cân bằng phương trình Mg+HCl-&gt;MgCl2+H2 bằng phương pháp thăng bằng
    5·1 answer
  • Explain how they would make solutions of the sulfuric acid at five different concentrations​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!