1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sladkaya [172]
3 years ago
10

A 1.0 L buffer solution is 0.300 M HC2H3O2 and 0.045 M LiC2H3O2. Which of the following actions will destroy the buffer?

Chemistry
1 answer:
zheka24 [161]3 years ago
5 0

Answer:

b) Adding 0.075 moles of HCl

Explanation:

A buffer is defined as the aqueous mixture of a weak acid and its conjugate base or vice versa (Weak base with its conjugate acid).

The buffer of the problem is the acetic acid / lithium acetate.

The addition of any moles of the acid and the conjugate base will not destroy the buffer, just would change the pH of the buffer. Thus, a and c will not destroy the buffer.

The addition of an acid (HCl) or a base (NaOH), produce the following reactions:

HCl + LiC₂H₃O₂ → HC₂H₃O₂ + LiCl

<em>The acid reacts with the conjugate base to produce the weak acid.</em>

<em />

And:

NaOH + HC₂H₃O₂  →NaC₂H₃O₂ + H₂O

<em>The base reacts with the weak acid to produce conjugate base.</em>

<em />

As the buffer is 1.0L, the moles of the species of the buffer are:

HC₂H₃O₂ = 0.300 moles

LiC₂H₃O₂ = 0.045 moles

The reaction of HCl with LiC₂H₃O₂ consume all LiC₂H₃O₂ -<em>because there are an excess of moles of HCl that react with all </em>LiC₂H₃O₂-

As you will have just HC₂H₃O₂ after the reaction, the addition of b destroy the buffer.

In the other way, 0.0500 moles of NaOH react with the HC₂H₃O₂ but not consuming all HC₂H₃O₂, thus d doesn't destroy the buffer.

You might be interested in
What is the percentage error of a length measure of 0.229 cm if the correct value is 0.225 cm
olchik [2.2K]
((|Vtrue-Vobserved|) / (Vtrue)) x 100

1.77777%error
8 0
3 years ago
How many moles of water are in a beaker with 50 mL?
tatiyna

Answer:

Number of moles = 2.8 mol

Explanation:

Given data:

Number of moles of water = ?

Volume of water = 50 mL

Density of water = 1.00 g/cm³

Solution:

1 cm³ =  1 mL

Density = mass/ volume

1.00 g/mL = mass/ 50 mL

Mass = 1.00 g/mL× 50 mL

Mass = 50 g

Number of moles of water:

Number of moles = mass/molar mass

Number of moles = 50 g / 18 g/mol

Number of moles = 2.8 mol

5 0
3 years ago
Calculate density of aluminum if 27.6cm^3 has a mass of 74.6g
rjkz [21]
First , 27.6 cm^3 is equal to 27.6 ml

Density = mass g / volume cm^3

= 74.6 / 27.6 = ........ g/cm^3
6 0
3 years ago
Read 2 more answers
In Atomic Absorption Spectrophotometry, narrow atomic lines are desirable. However, line broadening arises from: (a) Jablonski e
LenKa [72]

Answer: b) Doppler Effect

Explanation:

Line broadening in AAS, arises due to some effects, which can occur due to a number of factors. The line width broadening effects include: Doppler, Lorentz, Self absorption, and quenching effects.

Doppler effect arises because along the line of observation, atoms will have different components of velocity.

7 0
4 years ago
Use your understanding of the terms "soluble" and "insoluble" to explain why you must shake a bottle of salad dressing made with
tekilochka [14]

Answer:

See explanation

Explanation:

In chemistry, the idea of "like dissolves like" is of utmost importance. A substance is only soluble in another with which it can effectively interact.

We must note that to be "soluble" means that the solute actually interacts effectively (dissolves) in the solvent.

However, vinegar is a polar substance while oil is a non polar substance hence the two can not effectively interact. That is, the vinegar can not dissolve in oil.

The two will separate into two phases upon standing. Therefore, the bottle of salad dressing made with oil and vinegar must be shaken in order to mix the two thoroughly before it is used.

6 0
3 years ago
Other questions:
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Which subatomic particle plays the greatest part in determining the properties of an element?
    5·2 answers
  • Still need a good answer heterogeneous vs homogeneous, don't copy from web pls.
    13·1 answer
  • The United States is a major producer of what element?
    7·2 answers
  • Find the percentage compositions<br> CaCl2<br> Ca:<br> CI:
    7·1 answer
  • Of the following transitions in the Bohr hydrogen atom, which of the following
    10·1 answer
  • Calculate the volume of oxygen at NTP obtained by decomposing 12.26g of KCLO3(at wt. K=39.1, Cl=35.5 and O = 16)​
    12·1 answer
  • Butane gas reacts with oxygen gas to give carbon dioxide gas and water vapor (gas). If you mix butane and oxygen in the correct
    6·1 answer
  • A chemist wants to combine sodium with a halogen. The halogen must have a higher atomic mass than sodium. Which of the following
    12·1 answer
  • What is the change in enthalpy when 11. 0 g of liquid mercury is heated by 15°c?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!